- Input PCR template
-  
- Range
- 1 - 564
- Specificity of primers
- Primer pairs are specific to input template as no other targets were found in selected database: NCBI Transcript Reference Sequences (Organism limited to Homo sapiens)
Detailed primer reports
Primer pair 1
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | CGGCTTAACGGTACTTGGAG | Minus | 20 | 449 | 430 | 59.76 | 55.00% |
| Internal oligo | Plus | ||||||
| Product length | 399 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 2
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | GGCAAGGAATTTGTCCAGAG | Minus | 20 | 409 | 390 | 59.67 | 50.00% |
| Internal oligo | Plus | ||||||
| Product length | 359 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 3
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | AGGCAAGGAATTTGTCCAGA | Minus | 20 | 410 | 391 | 59.67 | 45.00% |
| Internal oligo | Plus | ||||||
| Product length | 360 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 4
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | GAGGCAAGGAATTTGTCCAG | Minus | 20 | 411 | 392 | 59.67 | 50.00% |
| Internal oligo | Plus | ||||||
| Product length | 361 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 5
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | TGTGAAATCTCCAGGGTGGT | Minus | 20 | 373 | 354 | 60.36 | 50.00% |
| Internal oligo | Plus | ||||||
| Product length | 323 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 6
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | GTGTGAAATCTCCAGGGTGG | Minus | 20 | 374 | 355 | 60.36 | 55.00% |
| Internal oligo | Plus | ||||||
| Product length | 324 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 7
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | GGTGTGAAATCTCCAGGGTG | Minus | 20 | 375 | 356 | 60.36 | 55.00% |
| Internal oligo | Plus | ||||||
| Product length | 325 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 8
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | ACAGGATCCACACGCAGTTT | Minus | 20 | 306 | 287 | 60.58 | 50.00% |
| Internal oligo | Plus | ||||||
| Product length | 256 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 9
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | AGGATCCACACGCAGTTTGT | Minus | 20 | 304 | 285 | 60.58 | 50.00% |
| Internal oligo | Plus | ||||||
| Product length | 254 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates
Primer pair 10
| Sequence (5'->3') | Strand on template | Length | Start | Stop | Tm | GC% | |
|---|---|---|---|---|---|---|---|
| Forward primer | AGAACTGCTGGGGGAAGATT | Plus | 20 | 51 | 70 | 60.07 | 50.00% |
| Reverse primer | AGGTCGCTCAGAGTGGACAG | Minus | 20 | 276 | 257 | 60.61 | 60.00% |
| Internal oligo | Plus | ||||||
| Product length | 226 | ||||||
| Product Tm | |||||||
| Product Tm - min(OLIGO Tm) | |||||||
Products on intended target
Products on allowed transcript variants
Products on potentially unintended templates
Products on target templates




